circad | circRNAs associated with diseases

Hsa_circ_0009910
Gene	MFN2	Organism	Human
Genome Locus	chr1:12049221-12052747:+	Build	hg19
Disease	Osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink	Link to database	PMID	29117539
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	30 OS tissues and 30 adjacent non-tumor tissues (located 3 cm away from the tumor) and Human OS cell lines (MG63, Saos-2 and U2OS) and fetal osteoblasticcell line hFOB
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGAGAGGCATCAGTGAGGTG Reverse AAGTGCTTAAGTGGGGATGC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Deng, N, Li, L, Gao, J, Zhou, J, Wang, Y, Wang, C, Liu, Y (2018). Hsa_circ_0009910 promotes carcinogenesis by promoting the expression of miR-449a target IL6R in osteosarcoma. Biochem. Biophys. Res. Commun., 495, 1:189-196.